Dynamic Binding Capacity and High‑Resolution Oligonucleotide Analysis with Agilent Bio SAX Columns
Technical notes | 2022 | Agilent TechnologiesInstrumentation
Consumables, HPLC, LC columns
IndustriesPharma & Biopharma
ManufacturerAgilent Technologies
Key wordsresponse, oligonucleotide, binding, relative, sax, capacity, bio, nonporous, min, dbc, union, phase, retention, time, oligonucleotides, mobile, column, columns, cleanup, rna, exchange, gactgagtttgttttatataaaacgggcgcaatgtctgctttgatcaac, dynamic, outlined, agggaaattcgcgcccataacttggt, cacgtgaaacattgctaaaccctca, cagattcgttcttacccatactcca, catataagttgcgttacttcggcct, ccgaatacgggttcttgcatcgttc, ccgttggcagggggatcgcatgtcc, cctaaccgcacccttagcacgaaga, ggtctctgagcgacaaaagctttaa, hsiao, jordy, agilent, separation, were, charged, gradient, anion, turner, matt, only, particle, aex, increases, resolution, impurities, grafted, explores
Similar PDF
Oligonucleotide Analysis: Practical Techniques and Method Development Optimization for HPLC
2023|Agilent Technologies|Presentations
Oligonucleotide Analysis: Practical Techniques and Method Development Optimization for HPLC Mohit Patel LC Columns and Consumables Technical Support December 19, 2023 1 12/19/2023 DE # DE48216954 What Are Oligonucleotide Therapeutic Types? Oligonucleotides are being increasingly developed as therapeutics against a…
Key words
oligonucleotide, oligonucleotideoligonucleotides, oligonucleotidesadvancebio, advancebiopair, pairladder, ladderbuffer, buffermau, mauresolution, resolutionrcrarcrurgrararurarcrcrararu, rcrarcrurgrararurarcrcrararurgrurcrarurcrarcrarcrurgrararurarcrcrararu, rgrurcrarurcrarcrarcrurgrararurarcrcrararururcrarcrarcrurgrararurarcrcrararu, rurcrarcrarcrurgrararurarcrcrararururcrarurcrarcrarcrurgrararurarcrcrararu, rurcrarurcrarcrarcrurgrararurarcrcrararuion, ionphase, phasebinding
Dynamic Binding Capacity of Oligonucleotides on PLRP-S Columns and Stationary Phases
2022|Agilent Technologies|Technical notes
Technical Overview Dynamic Binding Capacity of Oligonucleotides on PLRP-S Columns and Stationary Phases Author Dr. Andrew Coffey Agilent Technologies, Inc. Abstract PLRP-S is a polymeric polystyrene/divinylbenzene (PS/DVB) reversed-phase material that is ideally suited to oligonucleotide separation and purification, and is…
Key words
dbc, dbcresponse, responseoligonucleotide, oligonucleotidepore, porerelative, relativeplrp, plrpbinding, bindingstationary, stationaryphase, phaseretention, retentiontime, timebarrel, barrelcapacity, capacitysize, sizemin
Oligonucleotide Purification Solutions - Agilent PLRP-S and PL-SAX HPLC columns
2022|Agilent Technologies|Brochures and specifications
Oligonucleotide Purification Solutions Agilent PLRP-S and PL-SAX HPLC columns R + + R + R R + PL-SAX 1000 Å Pore Size 1000 Å PLRP-S 1000 Å Pore Size 1000 Å It’s All About Scalability Whether you’re working on the…
Key words
mer, mersax, saxrna, rnaoligonucleotide, oligonucleotideoligonucleotides, oligonucleotidescolumns, columnsplrp, plrpyou, youpurification, purificationnmoles, nmolessize, sizethiolated, thiolatedagilent, agilentaso, asoparticle
Analysis of Oligonucleotides with Ion Exchange Chromatography and Agilent Infinity II UHPLC
2022|Agilent Technologies|Applications
Application Note Biopharmaceuticals Analysis of Oligonucleotides with Ion Exchange Chromatography and Agilent Infinity II UHPLC Authors Abstract Chae-Young Ryu and Brian Liau Agilent Technologies, Inc. Although oligonucleotide analysis is frequently conducted using ion-pair reversed‑phase chromatography, ion exchange chromatography can be…
Key words
mau, mausax, saxoligonucleotide, oligonucleotidemin, mintime, timeoligonucleotides, oligonucleotidesssdna, ssdnaladder, ladderbio, biocolumns, columnsexchange, exchangeresolution, resolutionseparations, separationsagilent, agilentnacl