Thermo Scientific DNAPac Family of Columns
Brochures and specifications | 2022 | Thermo Fisher ScientificInstrumentation
Consumables, LC columns
IndustriesPharma & Biopharma
ManufacturerThermo Fisher Scientific
Key wordsdnapac, oligonucleotide, min, absorbance, time, phosphothioate, length, format, phosphorothioated, diastereoisomers, rna, dnaswift, oligonucleotides, column, particle, size, mau, polymeric, long, linkage, guard, adenine, lifetimes, compatible, beads, athioate, ctgattgtaggttctctaacgctgg, phosphorothioted, supermarcoporous, abundance, gattgtaggttctctaacgct, vaccinations, nano, dna, resin, cartidges, porous, media, relative, analysis, hplc, your, columns, short, base, plasmid, separations, invest, reversed, purifications
Similar PDF
2019/2021 Chromatography Consumables Catalog - Bio LC columns and accessories
2019|Thermo Fisher Scientific|Others
Connected chromatography solutions 2019/2021 Chromatography Consumables Catalog The collective power of chromatography Expect reproducible results with sample prep, columns and vials Maximizing your chromatography productivity and achieving reproducible results requires optimizing the whole workflow from sample to knowledge. By choosing…
Key words
columns, columnsmabpac, mabpacsize, sizelength, lengthcolumn, columnparticle, particlebiolc, biolcproswift, proswiftprotein, proteinpropac, propacvariants, variantsexchange, exchangeresolution, resolutionaccessories, accessoriesbiobasic
BioLC columns and accessories (Chromatography consumables catalog)
2022|Thermo Fisher Scientific|Brochures and specifications
Chromatography consumables Connected chromatography solutions Chromatography consumables catalog Comprehensive products to support your chromatography workflows Sample preparation solutions Sample handling solutions Low-flow LC columns and accessories BioLC columns and accessories LC columns and accessories GC columns and accessories • EASY-Spray™…
Key words
columns, columnsbiolc, biolcmabpac, mabpacsize, sizeaccesories, accesoriesphase, phasemobile, mobilereading, readingcolumn, columnbuffer, buffervariant, variantpore, porehplc, hplclength, lengthmab
High Resolution LC/MS Analysis of Therapeutic Oligonucleotides on a New Porous Polymer-Based Reversed Phase Column
2016|Thermo Fisher Scientific|Applications
0 Introduction 100 80 Relative Abundance Synthetic ONs with different functionalities including antisense ONs, small interfering RNAs (siRNAs), aptamers and immunostimulatory RNAs (isRNAs) are candidate therapeutic agents due to their specificity, and well-established synthesis and modification technologies. Still characterization is…
Key words
abundance, abundancesirnas, sirnasrelative, relativemeoa, meoameou, meoucpg, cpgmethylated, methylatedphosphorothioate, phosphorothioateabsorbance, absorbanceexactive, exactivesequences, sequencesons, onsmau, maumodified, modifiedagcugacccugaag
LC columns and accessories for biomolecules
2020|Thermo Fisher Scientific|Brochures and specifications
1.5 1.0 0.5 LC columns and accessories for biomolecules Technical resources document Contents Introduction 03 Bio columns selection guide 04 HPLC phases for biomolecules 05 Columns for protein separations 05 Columns for carbohydrate separations 08 Columns for oligonucleotide separations 09…
Key words
proswift, proswiftexchange, exchangemabpac, mabpacnonporous, nonporouscolumns, columnsmonolith, monolithbiobasic, biobasicprotein, proteinseparations, separationsphase, phaseresolution, resolutionpropac, propacsize, sizeparticle, particlesilica