Molecular Confirmation of Oligonucleotides Using Agilent LC/MSD XT and OpenLab CDS
Applications | 2024 | Agilent TechnologiesInstrumentation
Accurate molecular weight confirmation of synthetic oligonucleotides is vital for quality control in research, therapeutic development, and diagnostic applications. Rapid and reliable workflows using liquid chromatography–mass spectrometry (LC–MS) enable manufacturers and laboratories to verify sequence integrity, detect impurities, and ensure product consistency, particularly when working with modified backbones, bases, or labels.
This study demonstrates a streamlined approach for molecular weight confirmation and preliminary characterization of synthetic oligonucleotides using an Agilent LC/MSD XT single quadrupole system coupled with OpenLab CDS 2.8 spectral deconvolution. The workflow is evaluated with a DNA ladder standard (15–40mer) and modified antisense oligonucleotides (ASOs) to illustrate method applicability across various lengths and chemistries.
Analysis of a 21mer DNA oligonucleotide revealed broad charge state distributions (z = 8–9 dominant) with overlapping m/z signals, underscoring the need for empirical method optimization. The DNA ladder (15–40mer) produced distinct charge envelopes, and deconvoluted masses matched theoretical values within ±1 Da (9–84 ppm). Deconvolution of 18mer and 20mer ASOs, using a narrowed mass range (6,000–8,000 Da), successfully identified full-length products and n–1 impurities, with mass errors under 1 Da. Detection of low-level impurities (0.12% of main peak) demonstrated the sensitivity of optimized processing parameters.
These workflows allow rapid molecular weight verification and preliminary purity assessment of synthetic oligonucleotides in medium- to high-throughput settings. The integration of user-friendly software and robust hardware supports routine quality control in pharmaceutical research, oligo manufacturing, and analytical laboratories.
Advances may include integration of high-resolution accurate mass systems for detailed impurity profiling, automated method optimization using machine learning, expanded libraries of modified oligonucleotides, and deeper structural characterization via tandem MS or ion mobility. Continued software enhancements will further streamline data processing and reporting.
The combination of Agilent’s 1290 Infinity II LC, LC/MSD XT, and OpenLab CDS 2.8 spectral deconvolution offers a rapid, reliable solution for molecular weight confirmation and basic characterization of synthetic oligonucleotides. This platform meets the demands of modern analytical workflows where speed, accuracy, and ease of use are paramount.
LC/MS, LC/SQ
IndustriesPharma & Biopharma
ManufacturerAgilent Technologies
Summary
Significance of the Topic
Accurate molecular weight confirmation of synthetic oligonucleotides is vital for quality control in research, therapeutic development, and diagnostic applications. Rapid and reliable workflows using liquid chromatography–mass spectrometry (LC–MS) enable manufacturers and laboratories to verify sequence integrity, detect impurities, and ensure product consistency, particularly when working with modified backbones, bases, or labels.
Objectives and Study Overview
This study demonstrates a streamlined approach for molecular weight confirmation and preliminary characterization of synthetic oligonucleotides using an Agilent LC/MSD XT single quadrupole system coupled with OpenLab CDS 2.8 spectral deconvolution. The workflow is evaluated with a DNA ladder standard (15–40mer) and modified antisense oligonucleotides (ASOs) to illustrate method applicability across various lengths and chemistries.
Methodology
- Sample Preparation: DNA ladder and ASO standards dissolved in deionized water; final concentrations of 4 nmol/µL (ladder) or 50 µg/mL.
- Chromatography: Agilent AdvanceBio oligonucleotide column (2.1×50 mm, 2.7 µm); mobile phases of 100 mM HFIP/15 mM TEA (A) and methanol (B); gradient from 15% to 95% B over 11 min; 0.5 mL/min flow; 65 °C column temperature; 2 µL injection.
- Spectral Deconvolution: OpenLab CDS 2.8 with optimized settings for m/z range (1,000–3,000), charge state envelope, noise thresholds, and curve fit algorithm.
Used Instrumentation
- Agilent 1290 Infinity II BioLC or passivated 1290 Infinity II LC system for chromatographic separation.
- Agilent LC/MSD XT (G6135C) single quadrupole mass spectrometer with AJS ESI source.
- OpenLab CDS 2.8 software for instrument control and MS spectral deconvolution.
Main Results and Discussion
Analysis of a 21mer DNA oligonucleotide revealed broad charge state distributions (z = 8–9 dominant) with overlapping m/z signals, underscoring the need for empirical method optimization. The DNA ladder (15–40mer) produced distinct charge envelopes, and deconvoluted masses matched theoretical values within ±1 Da (9–84 ppm). Deconvolution of 18mer and 20mer ASOs, using a narrowed mass range (6,000–8,000 Da), successfully identified full-length products and n–1 impurities, with mass errors under 1 Da. Detection of low-level impurities (0.12% of main peak) demonstrated the sensitivity of optimized processing parameters.
Practical Benefits and Applications
These workflows allow rapid molecular weight verification and preliminary purity assessment of synthetic oligonucleotides in medium- to high-throughput settings. The integration of user-friendly software and robust hardware supports routine quality control in pharmaceutical research, oligo manufacturing, and analytical laboratories.
Future Trends and Applications
Advances may include integration of high-resolution accurate mass systems for detailed impurity profiling, automated method optimization using machine learning, expanded libraries of modified oligonucleotides, and deeper structural characterization via tandem MS or ion mobility. Continued software enhancements will further streamline data processing and reporting.
Conclusion
The combination of Agilent’s 1290 Infinity II LC, LC/MSD XT, and OpenLab CDS 2.8 spectral deconvolution offers a rapid, reliable solution for molecular weight confirmation and basic characterization of synthetic oligonucleotides. This platform meets the demands of modern analytical workflows where speed, accuracy, and ease of use are paramount.
References
- Chen B.; Mason S. F.; Bartlett M. G. The Effect of Organic Modifiers on Electrospray Ionization Charge-State Distribution and Desorption Efficiency for Oligonucleotides. Journal of the American Society for Mass Spectrometry 2013, 24(2), 257–264. doi:10.1007/s13361-012-0509-5
- Basiri B.; Murph M. M.; Bartlett M. G. Assessing the Interplay Between the Physicochemical Parameters of Ion-pairing Reagents and the Analyte Sequence on the Electrospray Desorption Process for Oligonucleotides. Journal of the American Society for Mass Spectrometry 2017, 28(8), 1647–1656. doi:10.1007/s13361-017-1671-6
Content was automatically generated from an orignal PDF document using AI and may contain inaccuracies.
Similar PDF
Oligonucleotide Mass Confirmation and Impurity Identification
2024|Agilent Technologies|Applications
Application Note Biopharma Oligonucleotide Mass Confirmation and Impurity Identification Using Agilent InfinityLab LC/MSD XT and Agilent OpenLab CDS Author Bian Yulan Agilent Technologies, Inc. Abstract This application note highlights the use of the Agilent InfinityLab LC/MSD XT system on molecular…
Key words
ttt, tttmass, masscdna, cdnadeconvolution, deconvolutionmsd, msdaptamer, aptamercloning, cloningflp, flpprimer, primerinfinitylab, infinitylabcharge, chargeoligo, oligothreshold, thresholdspectrum, spectrumoligonucleotide
Systematic Evaluation of Hydrophilic Interaction Liquid Chromatography Stationary Phases for Oligonucleotide Characterization by LC/MS
2024|Agilent Technologies|Posters
Poster Reprint ASMS 2024 Poster number WP 573 Systematic Evaluation of Hydrophilic Interaction Liquid Chromatography Stationary Phases for Oligonucleotide Characterization by LC/MS Jordy J. Hsiao1, Alex Apffel1, Lee Bertram1, Andrea Angelo P. Tripodi2, Andrew Coffey2, Ta-Chen Wei3, Connor Flannery1 1Agilent…
Key words
hilic, hilictanaka, tanakaoligo, oligooligos, oligosoligonucleotide, oligonucleotidephases, phasesiex, iexinteraction, interactionamide, amidestationary, stationaryglycan, glycanchromatographic, chromatographicmedia, mediaantisense, antisenseuridine
Oligonucleotide Characterization by Agilent 1290 Infinity II Bio LC and 6545XT AdvanceBio LC/Q-TOF
2023|Agilent Technologies|Applications
Application Note Pharma & Biopharma Oligonucleotides Oligonucleotide Characterization by Agilent 1290 Infinity II Bio LC and 6545XT AdvanceBio LC/Q-TOF Oligonucleotide identity, impurities analysis and sequence determination using BioConfirm 12.0 target plus impurities (TPI) and sequence confirmation workflows Authors Introduction Bian…
Key words
oligonucleotide, oligonucleotideaso, asosequence, sequencetpi, tpicounts, countsacquisition, acquisitionconfirmation, confirmationoligonucleotides, oligonucleotidesworkflow, workflowcharge, chargeimpurities, impuritiesbioconfirm, bioconfirmmass, massagilent, agilentfluoro
High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry
2025|Agilent Technologies|Posters
Poster Reprint ASMS 2025 Poster number ThP 565 High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry Guannan Li and Lee Bertram Agilent Technologies, Inc., Santa Clara, CA Introduction Experimental Oligonucleotides are commonly analyzed by…
Key words
givosiren, givosirenoligos, oligosaso, asofomivirsen, fomivirsenantisense, antisensesense, senseoligo, oligoagca, agcaagcatgcatacaagaatgaatacatgca, agcatgcatacaagaatgaatacatgcacatgcatgcatgcatgcatgcatgcatg, catgcatgcatgcatgcatgcatgcatgmcfamgfamgfumamgfa, mcfamgfamgfumamgfamgfumcfumufufcmufcfa, mgfumcfumufufcmufcfamgmamamafgmafgmufg, mgmamamafgmafgmufgtgcatgcatgca, tgcatgcatgcatgcatgcatgcatgaatgcatgcataca