LCMS
More information
WebinarsAbout usContact usTerms of use
LabRulez s.r.o. All rights reserved. Content available under a CC BY-SA 4.0 Attribution-ShareAlike

Molecular Confirmation of Oligonucleotides Using Agilent LC/MSD XT and OpenLab CDS

Applications | 2024 | Agilent TechnologiesInstrumentation
LC/MS, LC/SQ
Industries
Pharma & Biopharma
Manufacturer
Agilent Technologies

Summary

Significance of the Topic


Accurate molecular weight confirmation of synthetic oligonucleotides is vital for quality control in research, therapeutic development, and diagnostic applications. Rapid and reliable workflows using liquid chromatography–mass spectrometry (LC–MS) enable manufacturers and laboratories to verify sequence integrity, detect impurities, and ensure product consistency, particularly when working with modified backbones, bases, or labels.

Objectives and Study Overview


This study demonstrates a streamlined approach for molecular weight confirmation and preliminary characterization of synthetic oligonucleotides using an Agilent LC/MSD XT single quadrupole system coupled with OpenLab CDS 2.8 spectral deconvolution. The workflow is evaluated with a DNA ladder standard (15–40mer) and modified antisense oligonucleotides (ASOs) to illustrate method applicability across various lengths and chemistries.

Methodology


  • Sample Preparation: DNA ladder and ASO standards dissolved in deionized water; final concentrations of 4 nmol/µL (ladder) or 50 µg/mL.
  • Chromatography: Agilent AdvanceBio oligonucleotide column (2.1×50 mm, 2.7 µm); mobile phases of 100 mM HFIP/15 mM TEA (A) and methanol (B); gradient from 15% to 95% B over 11 min; 0.5 mL/min flow; 65 °C column temperature; 2 µL injection.
  • Spectral Deconvolution: OpenLab CDS 2.8 with optimized settings for m/z range (1,000–3,000), charge state envelope, noise thresholds, and curve fit algorithm.

Used Instrumentation


  1. Agilent 1290 Infinity II BioLC or passivated 1290 Infinity II LC system for chromatographic separation.
  2. Agilent LC/MSD XT (G6135C) single quadrupole mass spectrometer with AJS ESI source.
  3. OpenLab CDS 2.8 software for instrument control and MS spectral deconvolution.

Main Results and Discussion


Analysis of a 21mer DNA oligonucleotide revealed broad charge state distributions (z = 8–9 dominant) with overlapping m/z signals, underscoring the need for empirical method optimization. The DNA ladder (15–40mer) produced distinct charge envelopes, and deconvoluted masses matched theoretical values within ±1 Da (9–84 ppm). Deconvolution of 18mer and 20mer ASOs, using a narrowed mass range (6,000–8,000 Da), successfully identified full-length products and n–1 impurities, with mass errors under 1 Da. Detection of low-level impurities (0.12% of main peak) demonstrated the sensitivity of optimized processing parameters.

Practical Benefits and Applications


These workflows allow rapid molecular weight verification and preliminary purity assessment of synthetic oligonucleotides in medium- to high-throughput settings. The integration of user-friendly software and robust hardware supports routine quality control in pharmaceutical research, oligo manufacturing, and analytical laboratories.

Future Trends and Applications


Advances may include integration of high-resolution accurate mass systems for detailed impurity profiling, automated method optimization using machine learning, expanded libraries of modified oligonucleotides, and deeper structural characterization via tandem MS or ion mobility. Continued software enhancements will further streamline data processing and reporting.

Conclusion


The combination of Agilent’s 1290 Infinity II LC, LC/MSD XT, and OpenLab CDS 2.8 spectral deconvolution offers a rapid, reliable solution for molecular weight confirmation and basic characterization of synthetic oligonucleotides. This platform meets the demands of modern analytical workflows where speed, accuracy, and ease of use are paramount.

References


  • Chen B.; Mason S. F.; Bartlett M. G. The Effect of Organic Modifiers on Electrospray Ionization Charge-State Distribution and Desorption Efficiency for Oligonucleotides. Journal of the American Society for Mass Spectrometry 2013, 24(2), 257–264. doi:10.1007/s13361-012-0509-5
  • Basiri B.; Murph M. M.; Bartlett M. G. Assessing the Interplay Between the Physicochemical Parameters of Ion-pairing Reagents and the Analyte Sequence on the Electrospray Desorption Process for Oligonucleotides. Journal of the American Society for Mass Spectrometry 2017, 28(8), 1647–1656. doi:10.1007/s13361-017-1671-6

Content was automatically generated from an orignal PDF document using AI and may contain inaccuracies.

Downloadable PDF for viewing
 

Similar PDF

Toggle
Oligonucleotide Mass Confirmation and Impurity Identification
Application Note Biopharma Oligonucleotide Mass Confirmation and Impurity Identification Using Agilent InfinityLab LC/MSD XT and Agilent OpenLab CDS Author Bian Yulan Agilent Technologies, Inc. Abstract This application note highlights the use of the Agilent InfinityLab LC/MSD XT system on molecular…
Key words
ttt, tttmass, masscdna, cdnadeconvolution, deconvolutionmsd, msdaptamer, aptamercloning, cloningflp, flpprimer, primerinfinitylab, infinitylabcharge, chargeoligo, oligothreshold, thresholdspectrum, spectrumoligonucleotide
Systematic Evaluation of Hydrophilic Interaction Liquid Chromatography Stationary Phases for Oligonucleotide Characterization by LC/MS
Poster Reprint ASMS 2024 Poster number WP 573 Systematic Evaluation of Hydrophilic Interaction Liquid Chromatography Stationary Phases for Oligonucleotide Characterization by LC/MS Jordy J. Hsiao1, Alex Apffel1, Lee Bertram1, Andrea Angelo P. Tripodi2, Andrew Coffey2, Ta-Chen Wei3, Connor Flannery1 1Agilent…
Key words
hilic, hilictanaka, tanakaoligo, oligooligos, oligosoligonucleotide, oligonucleotidephases, phasesiex, iexinteraction, interactionamide, amidestationary, stationaryglycan, glycanmedia, mediachromatographic, chromatographicantisense, antisenseuridine
Oligonucleotide Characterization by Agilent 1290 Infinity II Bio LC and 6545XT AdvanceBio LC/Q-TOF
Application Note Pharma & Biopharma Oligonucleotides Oligonucleotide Characterization by Agilent 1290 Infinity II Bio LC and 6545XT AdvanceBio LC/Q-TOF Oligonucleotide identity, impurities analysis and sequence determination using BioConfirm 12.0 target plus impurities (TPI) and sequence confirmation workflows Authors Introduction Bian…
Key words
oligonucleotide, oligonucleotideaso, asosequence, sequencetpi, tpicounts, countsacquisition, acquisitionconfirmation, confirmationoligonucleotides, oligonucleotidesworkflow, workflowcharge, chargeimpurities, impuritiesbioconfirm, bioconfirmmass, massagilent, agilentfluoro
High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry
Poster Reprint ASMS 2025 Poster number ThP 565 High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry Guannan Li and Lee Bertram Agilent Technologies, Inc., Santa Clara, CA Introduction Experimental Oligonucleotides are commonly analyzed by…
Key words
givosiren, givosirenoligos, oligosaso, asofomivirsen, fomivirsenantisense, antisensesense, senseoligo, oligoagca, agcaagcatgcatacaagaatgaatacatgca, agcatgcatacaagaatgaatacatgcacatgcatgcatgcatgcatgcatgcatg, catgcatgcatgcatgcatgcatgcatgmcfamgfamgfumamgfa, mcfamgfamgfumamgfamgfumcfumufufcmufcfa, mgfumcfumufufcmufcfamgmamamafgmafgmufg, mgmamamafgmafgmufgtgcatgcatgca, tgcatgcatgcatgcatgcatgcatgaatgcatgcataca
Other projects
GCMS
ICPMS
Follow us
FacebookX (Twitter)LinkedInYouTube
More information
WebinarsAbout usContact usTerms of use
LabRulez s.r.o. All rights reserved. Content available under a CC BY-SA 4.0 Attribution-ShareAlike