Analysis of Oligonucleotides Using Ion-Pairing Alternatives on the Agilent Pro iQ Plus
Applications | 2025 | Agilent TechnologiesInstrumentation
The analysis of synthetic oligonucleotides is essential for advancing nucleic acid therapeutics, ensuring correct sequence synthesis, confirming molecular weight, and supporting quality control in research and biopharma production.
This application demonstrates an ion-pair-free LC/MS approach using ammonium bicarbonate on the Agilent InfinityLab Pro iQ Plus system, aiming for robust, high-throughput confirmation of various oligonucleotides, including antisense and siRNA sequences. The study evaluates chromatographic performance, mass accuracy, reproducibility, and data processing using Agilent OpenLab CDS deconvolution.
Sample Preparation:
Used Instrumentation:
Chromatography and MS Parameters:
The ammonium bicarbonate method achieved strong retention and sharp peaks for antisense oligos and siRNA without toxic reagents. Twenty replicate injections of three antisense sequences showed mass accuracy within 0.6 Da and relative standard deviations below 0.1%. siRNA duplex separation required slight gradient adjustment to 45 %B and reduced fragmentor voltage to preserve conjugates. Charge state distributions shifted to lower states, reducing spectral overlap. Automated deconvolution reliably identified full-length products, common impurities (depurination, sodium adducts), and potential conjugate losses.
The method can be extended to high-resolution MS for detailed impurity profiling and sequence confirmation. Further automation of sample handling and data processing may enable real-time monitoring. Exploration of alternative volatile buffers and solvent systems could improve sensitivity. Integration with regulatory-compliant software will facilitate broader adoption in pharmaceutical development.
The presented ammonium bicarbonate LC/MS workflow on the Agilent Pro iQ Plus offers a practical, robust, and environmentally friendly solution for oligonucleotide molecular confirmation. It delivers accurate mass data, reliable chromatographic performance, and streamlined analysis, supporting medium- to high-throughput laboratory operations.
LC/MS, LC/SQ
IndustriesPharma & Biopharma
ManufacturerAgilent Technologies
Summary
Importance of the Topic
The analysis of synthetic oligonucleotides is essential for advancing nucleic acid therapeutics, ensuring correct sequence synthesis, confirming molecular weight, and supporting quality control in research and biopharma production.
Goals and Study Overview
This application demonstrates an ion-pair-free LC/MS approach using ammonium bicarbonate on the Agilent InfinityLab Pro iQ Plus system, aiming for robust, high-throughput confirmation of various oligonucleotides, including antisense and siRNA sequences. The study evaluates chromatographic performance, mass accuracy, reproducibility, and data processing using Agilent OpenLab CDS deconvolution.
Methodology and Instrumentation
Sample Preparation:
- Oligonucleotides diluted to 50 μM in deionized water, stored at –80 °C.
- Transferred to temperature-controlled autosampler vials at 8 °C and analyzed within 48 hours.
Used Instrumentation:
- Agilent InfinityLab Pro iQ Plus LC/MS system with Jet Stream ESI source.
- Agilent Infinity II 1290 bio binary pump, multisampler, column compartment, and 1260 diode array detector HS.
Chromatography and MS Parameters:
- Column: Agilent AdvanceBio oligonucleotide, 2.1×50 mm, 2.7 μm at 75 °C.
- Mobile phases: 20 mM ammonium bicarbonate (A) and methanol (B), gradient 5–40 %B in 3 minutes at 0.7 mL/min.
- ESI in positive mode, m/z range 700–2800, optimized for lower charge states.
- Automated deconvolution in OpenLab CDS with unit mass settings, MW range 3000–10000 Da, curve-fit algorithm.
Results and Discussion
The ammonium bicarbonate method achieved strong retention and sharp peaks for antisense oligos and siRNA without toxic reagents. Twenty replicate injections of three antisense sequences showed mass accuracy within 0.6 Da and relative standard deviations below 0.1%. siRNA duplex separation required slight gradient adjustment to 45 %B and reduced fragmentor voltage to preserve conjugates. Charge state distributions shifted to lower states, reducing spectral overlap. Automated deconvolution reliably identified full-length products, common impurities (depurination, sodium adducts), and potential conjugate losses.
Benefits and Practical Applications
- Eliminates the need for toxic ion-pairing agents and dedicated negative-mode systems.
- Reduces buffer preparation time and instrument maintenance.
- Enables high-throughput, reproducible molecular weight confirmation for quality control.
- Simplifies data analysis with minimal optimization, supporting automated workflows.
Future Trends and Opportunities
The method can be extended to high-resolution MS for detailed impurity profiling and sequence confirmation. Further automation of sample handling and data processing may enable real-time monitoring. Exploration of alternative volatile buffers and solvent systems could improve sensitivity. Integration with regulatory-compliant software will facilitate broader adoption in pharmaceutical development.
Conclusion
The presented ammonium bicarbonate LC/MS workflow on the Agilent Pro iQ Plus offers a practical, robust, and environmentally friendly solution for oligonucleotide molecular confirmation. It delivers accurate mass data, reliable chromatographic performance, and streamlined analysis, supporting medium- to high-throughput laboratory operations.
Reference
- Herkt M, Thum T. Pharmacokinetics and Clinical Application of Nucleic Acid Therapeutics. Mol Ther. 2021;29(2):521–539.
- Watts JK, Corey DR. Silencing Disease Genes in the Laboratory and the Clinic. J Pathol. 2012;226(2):365–379.
- Apffel A, et al. Analysis of Oligonucleotides by HPLC–ESI-MS. Anal Chem. 1997;69(7):1320–1325.
- Guimaraes GJ, Bartlett MG. Role of Mobile Phase pH in Oligonucleotide LC-MS. Future Sci OA. 2021;7(10):FSO753.
- Basiri B, Murph MM, Bartlett MG. Interplay Between Ion-Pairing Reagents and Oligonucleotide Sequence. J Am Soc Mass Spectrom. 2017;28(8):1647–1656.
- Hayashi Y, Sun Y. Nonion Pair Approach for Oligonucleotide Analysis. J Am Soc Mass Spectrom. 2024;35(9):2034–2037.
- Chen B, Mason SF, Bartlett MG. Effect of Organic Modifiers on ESI of Oligonucleotides. J Am Soc Mass Spectrom. 2013;24(2):257–264.
Content was automatically generated from an orignal PDF document using AI and may contain inaccuracies.
Similar PDF
Analysis of Oligonucleotides Using an Ion-Pairing-Free Reversed-Phase Method with TOF LC/MS
2024|Agilent Technologies|Applications
Application Note Biopharmaceuticals Analysis of Oligonucleotides Using an Ion-Pairing-Free Reversed-Phase Method with TOF LC/MS Authors Lee Bertram and Jordy Hsiao Agilent Technologies, Inc. Abstract This application note details a reversed-phase separation methodology for oligonucleotides without the use ion pairing reagents.…
Key words
moera, moeramoerc, moercmoerg, moergcounts, countsmethoxyethoxy, methoxyethoxygivosiran, givosiranribose, ribosepairing, pairingoligonucleotides, oligonucleotidesoligonucleotide, oligonucleotidephase, phasemoert, moertacquisition, acquisitionreversed, reversedmass
Fast Track to Certainty: Confident Biopharma Decisions with LC-Single Quadrupole Mass Detection
2025|Agilent Technologies|Guides
Table of contents Fast Track to Certainty: Confident Biopharma Decisions with LC-Single Quadrupole Mass Detection How single quadrupole LC/MS simplifies identification, purification, and stability assessment in biopharma Table of Contents Introduction��������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������� 3 Consolidating Biopharma QC Workflows: LC/UV Versus Single Quadrupole…
Key words
contents, contentstable, tablemass, masspro, proplus, plusabundance, abundancetrastuzumab, trastuzumabmoera, moeraunknown, unknownrelative, relativeagilent, agilentabundances, abundancesmoe, moemoerc, moercthreshold
Small-Footprint Capillary UHPLC/MS Technology Significantly Reducing Consumption of PFAS Containing Modifiers for Fast and High-Resolution Separation of Synthetic Oligonucleotides
2025|Agilent Technologies|Posters
Poster Reprint ASMS 2025 Poster number MP 230 Small-Footprint Capillary UHPLC/MS Technology Significantly Reducing Consumption of PFAS Containing Modifiers for Fast and High-Resolution Separation of Synthetic Oligonucleotides Xiaoli Dong1, Cary Simpson2, Sam Foster2, Greg Ward2, Patrick Batoon1 1Agilent Technologies Inc,…
Key words
𝑚𝑖𝑛, 𝑚𝑖𝑛abundance, abundancemass, massoligonucleotide, oligonucleotidehfip, hfipmicroflow, microflowgivosiran, givosiranaxcend, axcendpairing, pairingdelta, deltamobile, mobileladder, ladderconsumption, consumptionphase, phasemeasured
High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry
2025|Agilent Technologies|Posters
Poster Reprint ASMS 2025 Poster number ThP 565 High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry Guannan Li and Lee Bertram Agilent Technologies, Inc., Santa Clara, CA Introduction Experimental Oligonucleotides are commonly analyzed by…
Key words
givosiren, givosirenoligos, oligosaso, asofomivirsen, fomivirsenantisense, antisensesense, senseoligo, oligoagca, agcaagcatgcatacaagaatgaatacatgca, agcatgcatacaagaatgaatacatgcacatgcatgcatgcatgcatgcatgcatg, catgcatgcatgcatgcatgcatgcatgmcfamgfamgfumamgfa, mcfamgfamgfumamgfamgfumcfumufufcmufcfa, mgfumcfumufufcmufcfamgmamamafgmafgmufg, mgmamamafgmafgmufgtgcatgcatgca, tgcatgcatgcatgcatgcatgcatgaatgcatgcataca