Small-Footprint Capillary UHPLC/MS Technology Significantly Reducing Consumption of PFAS Containing Modifiers for Fast and High-Resolution Separation of Synthetic Oligonucleotides

Posters | 2025 | Agilent Technologies | ASMSInstrumentation
LC/MS, LC/SQ
Industries
Pharma & Biopharma, Environmental
Manufacturer
Agilent Technologies

Summary

Significance of the Topic


Synthetic oligonucleotides are emerging as key agents in gene therapy, diagnostics and personalized medicine. Accurate characterization of these molecules requires high-resolution liquid chromatography coupled with mass spectrometry. Traditional ion-pairing methods employ PFAS modifiers such as HFIP and TEA, raising environmental and contamination concerns due to aerosol generation and persistent pollutants.

Study Objectives and Overview


This work aims to transfer a standard-flow oligonucleotide LC/MS method to a microflow capillary UHPLC platform. The goals are to achieve comparable chromatographic resolution and mass spectral performance while drastically reducing consumption of PFAS-containing modifiers and organic solvents.

Used Instrumentation


  • Axcend Focus LC with autosampler for microflow chromatography
  • Agilent Pro iQ Plus (G6170A) mass spectrometer with ESI source
  • OpenLab CDS 2.8 for data acquisition and deconvolution

Methodology


The capillary UHPLC method used a 100 mm × 0.15 mm, 1.8 µm particle HSS T-3 column. Mobile phase A consisted of 100 mM HFIP and 15 mM TEA in water; mobile phase B was methanol. A stepped gradient from 20 % to 95 % B over 12 minutes was delivered at 2 µL/min. Injection volumes were 250 nL. MS conditions employed negative-mode ESI, 300 °C drying gas, 6 L/min flow, 15 psi nebulizer and 4 kV capillary voltage. Data were processed via deconvolution to assign molecular weights.

Results and Discussion


  • DNA ladder standards (15–40 mers) and a custom 103-mer produced sharp, baseline-resolved peaks with mass accuracy within 0.8 Da of theoretical values.
  • Givosiran (GalNAc-conjugated siRNA) components, sense and antisense strands, were separated and correctly identified with Δ mass < 1 Da.
  • Chromatographic performance matched or exceeded standard-flow methods, preserving peak shape and resolution at greatly reduced modifier use.

Practical Implications and Applications


The microflow approach reduces methanol, HFIP and TEA consumption by over 99.5 % (a 220-fold decrease) compared to a 500 µL/min standard-flow protocol. This lowers reagent costs and PFAS exposure, minimizes lab contamination, and enables robust QC workflows for oligonucleotide therapeutics.

Future Trends and Potential Uses


Further miniaturization and integration with ultrahigh-resolution MS may drive even lower solvent use and higher throughput. Development of PFAS-free or alternative ion-pairing agents could enhance sustainability. Automated microfluidic platforms and high-throughput screening will expand application to varied oligonucleotide libraries and complex biologics.

Conclusion


The capillary UHPLC/MS method on the Axcend Focus LC achieves high-resolution oligonucleotide separations with dramatically reduced PFAS-containing modifier consumption. It delivers accurate mass assignments for standards and therapeutic oligos while supporting greener, cost-effective analytical workflows.

References


  1. Advancements in the characterisation of oligonucleotides by high performance liquid chromatography-mass spectrometry in 2021: A short review. Angewandte Analytik, 2021.
  2. Molecular Weight Confirmation of Oligonucleotides Using Agilent LC/MSD XT and OpenLab CDS. Application Note 5994-7083EN.

Content was automatically generated from an orignal PDF document using AI and may contain inaccuracies.

Downloadable PDF for viewing
 

Similar PDF

Toggle
Oligo Purity Analysis and Sequence Confirmation by LC/MS without Ion Pairing Reagents — Sample to reports in about 5 minutes
Poster Reprint ASMS 2023 Poster number ThP 576 Oligo Purity Analysis and Sequence Confirmation by LC/MS without Ion Pairing Reagents — Sample to reports in about 5 minutes Guannan Li1, Peter Rye2 , Vaughn Miller2 and Thomas Walker2 1Agilent Technologies,…
Key words
sequence, sequenceoligo, oligoacquisition, acquisitionconfirmation, confirmationpurity, purityoligos, oligosworklist, worklistmass, massbioconfirm, bioconfirmcagtagattgtactgtcctta, cagtagattgtactgtccttataagtacagtacaatcgactg, taagtacagtacaatcgactgoligonucleotides, oligonucleotidesrange, rangepairing, pairingoligonucleotide
Analysis of Oligonucleotides Using Ion-Pairing Alternatives on the Agilent Pro iQ Plus
Application Note Biopharma Analysis of Oligonucleotides Using Ion-Pairing Alternatives on the Agilent Pro iQ Plus Authors Lee Bertram and Brian Rivera Agilent Technologies, Inc. Abstract This application note presents a practical approach for medium- to high-throughput molecular confirmation of synthetic…
Key words
moera, moeramoerc, moercmoerg, moergmethoxyethoxy, methoxyethoxyoligonucleotides, oligonucleotidesabundance, abundanceribose, riboseantisense, antisensemolecular, molecularoligonucleotide, oligonucleotidemoert, moertmass, massthreshold, thresholdfomivirsen, fomivirsenpairing
Characterization of a synthetic double stranded siRNA using high-resolution mass spectrometry
APPLICATION BRIEF 74058 Characterization of a synthetic double stranded siRNA using high-resolution mass spectrometry Authors: Haichuan Liu1, Kevin Guo2, Julia Baek3, Jennifer Sutton1, Keeley Murphy1, Min Du2 Thermo Fisher Scientific, San Jose, CA 1 2 Thermo Fisher Scientific, Cambridge, MA…
Key words
sense, senseantisense, antisenseoligonucleotides, oligonucleotidessirna, sirnaabundance, abundancestranded, strandedrelative, relativedipea, dipeavanquish, vanquishdouble, doublediastereomers, diastereomersoligonucleotide, oligonucleotideacu, acuthermo, thermouga
A Software Workflow Using Wide Mass Range Single Quadrupole Mass Spectrometry Data Stream Applied to Oligonucleotides Confirmation
A Software Workflow Using Wide Mass Range Single Quadrupole Mass Spectrometry Data Stream Applied to Oligonucleotides Confirmation Risa Suzuki1, 2, Kosuke Uchiyama2, Noriko Kato2, Yuka Fujito2, Jeffery Dahl1, Simon Ashton3, Neil Loftus3, Atsuhiko Toyama2, 4 1Shimadzu Scientific Instruments, Inc., Columbia,…
Key words
charge, chargestate, statetbuaa, tbuaaoligonucleotide, oligonucleotidemipomersen, mipomersenmass, massbiologics, biologicsquadrupole, quadrupolerange, rangeinsight, insightsingle, singlemins, minsdata, datasummating, summatingmarked
Other projects
GCMS
ICPMS
Follow us
FacebookX (Twitter)LinkedInYouTube
More information
WebinarsAbout usContact usTerms of use
LabRulez s.r.o. All rights reserved. Content available under a CC BY-SA 4.0 Attribution-ShareAlike