LCMS
More information
WebinarsAbout usContact usTerms of use
LabRulez s.r.o. All rights reserved. Content available under a CC BY-SA 4.0 Attribution-ShareAlike

Wide-ranging polynucleotide separation capabilities using Reversed Phase particles with variable pore geometry

Posters | 2025 | Thermo Fisher Scientific | HPLC SymposiumInstrumentation
Consumables, LC columns
Industries
Pharma & Biopharma
Manufacturer
Thermo Fisher Scientific

Summary

Importance of Topic


Nucleic acids such as DNA and RNA are central to modern research, diagnostics and therapeutics, including gene editing, vaccine development and oligonucleotide drugs. Accurate separation and characterization of these biopolymers is essential for ensuring product purity, identifying variants and supporting downstream biological applications.

Objectives and Study Overview


This study evaluates a reversed phase chromatography particle with supermacroporous pore geometry and 4 micrometer polymer composition. The goal is to separate polynucleotides from tens to thousands of nucleotides in length, assess the effects of mobile phase composition, temperature and pH, and demonstrate method scale up from analytical to semi-preparative formats for sample purification and recovery.

Instrumentation


  • Thermo Scientific DNAPac RP columns, 4 micrometer particle size, formats: 2.1x50 mm, 2.1x100 mm and 21.2x150 mm
  • Vanquish H chromatography system with binary pump, autosampler and UV detector at 260 nm
  • Chromeleon chromatography data system (versions 7.2.10 and 7.3)

Methodology


Ion pairing reversed phase chromatography was performed using triethylamine acetate, hexylamine acetate and hexafluoroisopropanol as ion pairing agents. Gradient elution profiles were optimized for oligonucleotides of varying length. Separations were conducted at temperatures ranging from 30 to 60 C and mobile phase pH values of 7.9 and 9.9. Semi-preparative scaling was achieved by applying volumetric gradients based on column bed volume.

Main Results and Discussion


The polymeric supermacroporous particle exhibited a broad pore size distribution from 50 to 2500 angstroms, enabling efficient separation of oligonucleotides up to 10000 base pairs. High selectivity was observed for single stranded and double stranded nucleic acid mixtures, including siRNA, guide RNA and mRNA. Ion pairing reagent selection and mobile phase pH tuning improved resolution of stereoisomers. Analytical methods translated directly to semi-preparative scale with preserved or enhanced peak resolution and increased sample concentration in collected fractions.

Benefits and Practical Applications


  • High resolution across a wide range of nucleotide lengths from 10 to 10000 nt
  • Robust performance under varied mobile phase composition, pH and temperature conditions
  • Seamless scaling from analytical to preparative applications for purification and sample recovery
  • Enhanced mass transfer and enrichment due to supermacroporous particle structure

Future Trends and Opportunities


Further development of pore architectures may enable analysis of even larger nucleic acids and complex biomolecular conjugates. Integration with mass spectrometry and high throughput automation is anticipated to accelerate method development. Advanced data analytics and artificial intelligence may optimize separation parameters and support quality control in therapeutic oligonucleotide manufacturing.

Conclusion


The DNAPac RP supermacroporous reversed phase particle provides a versatile and scalable platform for high resolution separation of nucleic acids. Its broad pore distribution, chemical stability and compatibility with diverse mobile phases make it well suited for research, quality control and preparative purification of oligonucleotide based products.

Reference


  • K Musunuru et al Patient Specific In Vivo Gene Editing to Treat a Rare Genetic Disease New England Journal of Medicine 2025
  • J Maurer Malburet C Francois Heude M Guillarme D Evaluation of ion pairing reversed phase liquid chromatography for the separation of large RNA molecules Journal of Chromatography A 1740 465574 2025
  • K Ma et al A versatile reversed phase platform for short intermediate and long nucleic acid analysis HPLC 2023 Dusseldorf Germany

Content was automatically generated from an orignal PDF document using AI and may contain inaccuracies.

Downloadable PDF for viewing
 

Similar PDF

Toggle
A versatile reversed phase platform for short, intermediate, and long nucleic acid analysis
DNAPac RP Column A versatile reversed phase platform for short, intermediate, and long nucleic acid analysis Ke Ma1, Shane Bechler1, Ken Cook2, Shanhua Lin1. Thermo Fisher Scientific, 1 Sunnyvale, US; 2 Hertfordshire, England Abstract Long nucleic acid sample testing (up…
Key words
dnapac, dnapacgattgtaggttctctaacgctgattgtaggttctctaacgctgattgtaggttctctaa, gattgtaggttctctaacgctgattgtaggttctctaacgctgattgtaggttctctaavanquish, vanquishfastruler, fastrulerspaceghost, spaceghostladder, laddermin, mindna, dnatime, timegrna, grnapalindromic, palindromicinterspaced, interspacedphosphoramidite, phosphoramiditepossessing, possessingrepeats
Going big, small, and low: semi-prep columns with small particles for polynucleotide applications
Going big, small, and low: semi-prep columns with small particles for polynucleotide applications Shane Bechler1 , Simonas Balčiūnas2, James Peterman1, Simonas Dapkus3, Binalkumari Mistry1, Brandon Robson1, Matas Damonskis3, Shanhua Lin1 1Thermo Fisher Scientific, 527 Lakeside Dr., Sunnyvale, California, USA, 94085…
Key words
min, minmau, mausemi, semidsdna, dsdnaprep, prepseparations, separationsenlarged, enlargedanalytical, analyticalresolution, resolutionseparation, separationsample, sampletime, timecell, cellview, viewvariants
Thermo Scientific DNAPac Family of Columns
Thermo Scientific DNAPac Family of Columns
2022|Thermo Fisher Scientific|Brochures and specifications
Thermo Scientific DNAPac Family of Columns Superior Oligonucleotide Analysis DNAPac RP 2016 DNAPac PA200 RS 2013 DNASwift SAX-1S 2009 For over 30 years, the Thermo Scientific™ DNAPac™ family of columns has been the go-to for high resolution U/HPLC separation of…
Key words
dnapac, dnapacoligonucleotide, oligonucleotidemin, minabsorbance, absorbancetime, timephosphothioate, phosphothioatelength, lengthformat, formatdiastereoisomers, diastereoisomersphosphorothioated, phosphorothioatedrna, rnadnaswift, dnaswiftcolumn, columnoligonucleotides, oligonucleotidesparticle
High Resolution LC/MS Analysis of Therapeutic Oligonucleotides on a New Porous Polymer-Based Reversed Phase Column
0 Introduction 100 80 Relative Abundance Synthetic ONs with different functionalities including antisense ONs, small interfering RNAs (siRNAs), aptamers and immunostimulatory RNAs (isRNAs) are candidate therapeutic agents due to their specificity, and well-established synthesis and modification technologies. Still characterization is…
Key words
abundance, abundancerelative, relativesirnas, sirnasmeoa, meoameou, meoucpg, cpgmethylated, methylatedphosphorothioate, phosphorothioateexactive, exactiveabsorbance, absorbancesequences, sequencesons, onsmau, maumodified, modifiedagcugacccugaag
Other projects
GCMS
ICPMS
Follow us
More information
WebinarsAbout usContact usTerms of use
LabRulez s.r.o. All rights reserved. Content available under a CC BY-SA 4.0 Attribution-ShareAlike