Polymeric, porous, monodisperse particle development and application to reversed-phase separations of biological molecules

Posters | 2026 | Thermo Fisher Scientific | ASMSInstrumentation
HPLC, Consumables, LC columns
Industries
Pharma & Biopharma
Manufacturer
Thermo Fisher Scientific

Summary

Importance of the topic


High-performance separation of polynucleotides (oligonucleotides, siRNA, sgRNA, mRNA) is critical for therapeutic development, quality control, and nucleic-acid research. Conventional reversed-phase stationary phases optimized for small biomolecules often fail for high molecular weight polynucleotides due to limited pore accessibility and mass transfer limitations. Development of monodisperse, supermacroporous polymer particles addresses these constraints by combining controlled particle size distribution with tunable pore structure and surface chemistry to improve resolution across a broad molecular-weight range and enable mass-spectrometry compatible workflows.

Objectives and overview of the study


This work reports synthesis, physical characterization, and chromatographic evaluation of monodisperse supermacroporous polymer (SMP) particles designed for reversed-phase separations of biological macromolecules. Key aims were to (1) produce monodisperse particles small enough for high-efficiency separations without fines-induced backpressure, (2) map the interdependence of pore diameter, pore volume and surface area, (3) evaluate how pore architecture affects separation of polynucleotides from ~20 mer to >1000 mer, and (4) assess the influence of an incorporated tertiary amine comonomer on retention and separation, including performance with ion-pairing-free, MS-compatible mobile phases.

Methodology and particle synthesis


Particles were synthesized by emulsion polymerization from a monomer-crosslinker-porogen formulation to achieve precise particle-size control and low dispersity. Prototype particles targeted a monodisperse ~2.5 µm diameter distribution and were compared to a polydisperse ~4 µm benchmark. Pore architecture was varied to produce a range of specific surface areas (examples reported: ~317 to ~18 m2/g), corresponding pore diameters and BJH pore volumes. Some particle batches included low mole fractions of a tertiary amine comonomer (reported examples: 0.15%, 0.5%, 1.5%) to introduce cationic character to the phase.

Instrumentation used


Chromatography: Thermo Scientific Vanquish H system with Chromeleon 7.2.10 software; columns were 2.1 × 50 mm stainless-steel packed with prototype SMP particles. Particle/physical characterization: Beckman Coulter Multisizer 3 (particle sizing), Micromeritics ASAP (BET surface area and BJH pore analysis), Phenom ProX SEM (morphology). Typical chromatographic conditions reported include flow 0.4 mL/min, column temperature 50–60 °C, UV detection at 260 nm, and 2 µL injections. Mobile phases included TEAA (triethylammonium acetate) or 0.1 M ammonium acetate with acetonitrile; gradients and specific compositions varied by experiment.

Main results and discussion


  • Monodispersity and absence of fines: The emulsion-polymerized SMP particles achieved a narrow particle-size distribution at ~2.5 µm with negligible fines, enabling reduced diffusion pathlength without the backpressure penalty seen with polydisperse 4 µm resins that contain substantial submicron fines.

  • Pore architecture vs surface area: Higher BET surface area correlated with smaller average pore diameters and lower pore volumes; conversely, lower surface area prototypes exhibited larger pores and a more open morphology on SEM images. This structural control allows tailoring accessible surface for large analytes.

  • Polynucleotide separations: For small ssDNA oligomers (12–40 mer) retention decreased with decreasing particle surface area (i.e., larger pores reduce retention for small oligomers). For dsDNA ladders, short fragments followed the same trend, but the largest fragments (hundreds to >1000 bp) displayed increased retention on lower-surface-area (larger-pore) particles. This behavior is attributed to improved accessibility of the solid phase surface for high-molecular-weight analytes when pore diameters and interconnectivity are larger, increasing effective interaction and separation capability for long polynucleotides.

  • Large polynucleotides (siRNA, sgRNA, mRNA): Columns packed with ~2.5 µm, ~18 m2/g SMP particles provided effective separations of siRNA, sgRNA and mRNA; the open pore structure enabled chromatographic resolution across a wide size range.

  • Effect of tertiary amine comonomer: Incorporation of low levels of tertiary amine increased retention of anionic oligonucleotides in proportion to amine content, consistent with enhanced electrostatic interactions. A 0.5% amine-comonomer formulation produced greater retention and improved resolution relative to a neutral phase, and critically showed improved separations using ion-pairing-agent-free, MS-compatible mobile phases.

Benefits and practical applications


  • Broad molecular-weight coverage: SMP particles enable reversed-phase separations from short oligomers to long polynucleotides (including therapeutic-length mRNA) on a single stationary-phase family by tuning pore architecture.

  • Reduced backpressure for small particle diameters: Monodispersity removes fines, allowing use of small-diameter particles (improved efficiency) without the high-pressure penalty seen for polydisperse resins.

  • Improved MS compatibility: Introducing low levels of cationic comonomer can reduce reliance on traditional ion-pairing agents (which complicate MS detection), enabling cleaner workflows for LC–MS analysis of oligonucleotides.

  • Analytical and QC utility: The technology is applicable to method development and routine analysis in oligonucleotide therapeutics R&D, impurity profiling, batch release, and other QC contexts.

Future trends and opportunities for use


  • Further pore engineering: Optimizing pore size distribution and interconnectivity for even larger biopolymers (longer mRNAs, ribonucleoprotein complexes) or to minimize secondary-structure-dependent effects.

  • Hybrid chemistries and functionalization: Combining hydrophobic ligands and tailored ionic comonomers or ligand patterning to modulate selectivity for sequence, length, and chemical modifications.

  • UHPLC and low-pressure scaling: Translation of monodisperse SMPs to sub-2 µm formats for ultra-high-resolution separations while controlling pressure via macroporosity.

  • LC–MS integration: Further development to fully exploit ion-pair-free separations and direct coupling to mass spectrometry for intact oligonucleotide and impurity characterization.

  • Regulatory adoption and standardization: Validation of robust methods for therapeutic analytics and potential incorporation into regulatory guidance for oligonucleotide product testing.

Conclusions


Monodisperse supermacroporous polymer particles synthesized by controlled emulsion polymerization provide a practical route to high-resolution reversed-phase separations across a wide polynucleotide molecular-weight range. Control over particle size, pore diameter and surface area enables improved access of large biomolecules to the stationary phase, enhancing retention and resolution for long oligonucleotides and mRNA. Addition of low-level tertiary amine comonomer increases retention of anionic analytes and improves separations using MS-compatible, ion-pairing-free mobile phases. The combination of monodispersity and tunable macroporosity makes these particles promising for analytical and QC workflows in oligonucleotide therapeutics and related biomolecule separations.

Reference


Shanhua Lin, Shane Bechler, Ryan Cowley, Ke Ma, Yoginder Singh, Grete Modahl, Anette Valle, Geir Fonnum, Julia Baek, Chris Pohl. Polymeric, porous, monodisperse particle development and application to reversed-phase separations of biological molecules. Thermo Fisher Scientific, Sunnyvale CA & Oslo, Norway, 2026.

Content was automatically generated from an orignal PDF document using AI and may contain inaccuracies.

Downloadable PDF for viewing
 

Similar PDF

Toggle
Wide-ranging polynucleotide separation capabilities using Reversed Phase particles with variable pore geometry
DNAPac RP column Wide-ranging polynucleotide separation capabilities using Reversed Phase particles with variable pore geometry Christof Mitterer1, Mauro De Pra2, Shanhua Lin3, Shane Bechler3, Simonas Balčiūnas4, James Peterman3, Simonas Dapkus5, Binalkumari Mistry3, Brandon Robson3, Matas Damonskis5 1Thermo Fisher Scientific Langerwehe,…
Key words
mau, maupolynucleotides, polynucleotidesmin, minpore, porepolynucleotide, polynucleotideseparation, separationacn, acnstereoisomers, stereoisomersdnapac, dnapacstranded, strandedchromatogram, chromatogramtemperature, temperatureprep, prepsemi, semienlarged
A novel monodisperse supermacroporous reversed-phase platform for comprehensive nucleic acid analysis across a broad size range
Monodisperse, Supermacroporous A novel monodisperse supermacroporous reversed-phase platform for comprehensive nucleic acid analysis across a broad size range Ke Ma1, Robert Ross2, Shane Bechler1, Christof Mitter3, Mauro De Pra4, and Shanhua Lin1 1Thermo Fisher Scientific, 1228 Titan Way, Sunnyvale, CA…
Key words
surepac, surepacmdi, mdirurarg, rurargoligo, oligorarara, rarararcrara, rcrararargrc, rargrcacross, acrossbroad, broadnucleic, nucleicrarura, rarurarcrgrg, rcrgrgrcrgru, rcrgrurcrura, rcrurarcruru
A versatile reversed phase platform for short, intermediate, and long nucleic acid analysis
DNAPac RP Column A versatile reversed phase platform for short, intermediate, and long nucleic acid analysis Ke Ma1, Shane Bechler1, Ken Cook2, Shanhua Lin1. Thermo Fisher Scientific, 1 Sunnyvale, US; 2 Hertfordshire, England Abstract Long nucleic acid sample testing (up…
Key words
dnapac, dnapacgattgtaggttctctaacgctgattgtaggttctctaacgctgattgtaggttctctaa, gattgtaggttctctaacgctgattgtaggttctctaacgctgattgtaggttctctaavanquish, vanquishfastruler, fastrulerspaceghost, spaceghostladder, laddermin, mindna, dnatime, timegrna, grnapalindromic, palindromicinterspaced, interspacedphosphoramidite, phosphoramiditepossessing, possessingrepeats
Oligonucleotide Purification Solutions - Agilent PLRP-S and PL-SAX HPLC columns
Oligonucleotide Purification Solutions - Agilent PLRP-S and PL-SAX HPLC columns
2022|Agilent Technologies|Brochures and specifications
Oligonucleotide Purification Solutions Agilent PLRP-S and PL-SAX HPLC columns R + + R + R R + PL-SAX 1000 Å Pore Size 1000 Å PLRP-S 1000 Å Pore Size 1000 Å It’s All About Scalability Whether you’re working on the…
Key words
mer, mersax, saxrna, rnaoligonucleotides, oligonucleotidesoligonucleotide, oligonucleotidecolumns, columnsplrp, plrpyou, youpurification, purificationnmoles, nmolessize, sizethiolated, thiolatedagilent, agilentparticle, particleguide
Other projects
GCMS
ICPMS
Follow us
FacebookX (Twitter)LinkedInYouTube
More information
WebinarsAbout usContact usTerms of use
LabRulez s.r.o. All rights reserved. Content available under a CC BY-SA 4.0 Attribution-ShareAlike