An Integrated Software Ecosystem for End-to-End Oligonucleotides DataAcquisition, Analysis, and Reporting
Posters | 2026 | Agilent Technologies | ASMSInstrumentation
LC/MS, LC/MS/MS, Software, LC/TOF, LC/HRMS
IndustriesPharma & Biopharma
ManufacturerAgilent Technologies
Summary
Importance of the Topic
Comprehensive, reliable characterization of synthetic oligonucleotides (siRNA, ASO, gRNA, aptamers) is critical for therapeutic development, quality control, and regulatory submissions. Analytical workflows must confirm sequence identity, detect and quantify related impurities, and deliver traceable reports. Integrating acquisition, data processing, and reporting into a single ecosystem lowers manual workload, reduces turnaround time, and improves reproducibility for high-throughput oligonucleotide analysis.Objectives and Study Overview
This work describes an end-to-end software ecosystem implemented in a client–server architecture to automate data acquisition, analysis, and reporting for siRNA samples. The platform was evaluated using two therapeutic siRNA molecules (inclisiran and givosiran) in both denatured and non-denatured forms. Key goals were to demonstrate automated sample sequencing, reliable sequence confirmation (including MS/MS), impurity profiling, and generation of ready-to-use reports.Methodology
The analytical workflow combined ion-pair reversed-phase LC with time-of-flight mass spectrometry and diode-array detection. Samples were analyzed both denatured and native to capture conformational and impurity-related differences. Automated sample queues were configured using task and wait actions plus custom sample parameters to enable unattended multi-day operation with immediate post-acquisition processing and reporting. Targeted MS/MS experiments were used to achieve sequence coverage for both sense and antisense strands.Instrumentation Used
- LC: Agilent Altura Oligo HPH-C18 column (2.1 × 50 mm, 2.7 µm); flow 0.4 mL/min; typical column temperatures used to compare forms were 65 °C (denatured) and 25 °C (non-denatured).
- Mobile phases: A = 15 mM triethylamine (TEA) + 50 mM HFIP in water; B = methanol. Typical gradient reached ~40% B by 7 min and 90% B by 7.5 min; total run ~8 min.
- MS: Agilent 6545XT Q-TOF with DAD (UV detection at 260 nm). Representative MS settings: drying gas ~350 °C, drying gas flow ~12 L/min, nebulizer ~45 psi, sheath gas flow ~12 L/min and elevated sheath temperature; capillary ~3500 V, nozzle ~2000 V, fragmentor ~175 V, skimmer ~65 V.
- Acquisition: MS full scan m/z 400–3200 (≈1 spectrum/s). Targeted MS/MS acquisitions were used for sequence confirmation with higher scan rates (up to ≈4 spectra/s) and stepped collision energies (examples: 12, 15, 18, 20 V).
- Software: Integrated client–server software with BioConfirm modules for sequence confirmation, modification profiling, processing templates (e.g., Oligo_TPI.bcpmx, Oligo_SC.bcpmx) and a built-in report builder to produce automated, customizable reports.
Main Results and Discussion
- Automated end-to-end operation: The platform supported unattended sequences comprising injections, instrument state control, scheduled waits, and automated mass calibration, allowing samples to be processed without operator intervention across multiple days.
- Chromatography and MS data: Denatured and non-denatured forms of inclisiran and givosiran produced distinct UV and total ion chromatograms indicative of conformational or aggregation differences. Deconvoluted mass spectra provided clean monoisotopic mass assignments for intact strands.
- Sequence confirmation: Targeted MS/MS on selected high-charge states (e.g., −10/−11 for antisense, −9/−13 for sense in inclisiran) produced 100% sequence coverage for both strands of inclisiran, demonstrating the platform’s ability to confirm primary sequence reliably.
- Processing and reporting: Predefined processing methods and report templates enabled consistent impurity profiling and sequence confirmation reports. The report builder supported automated generation of sequence confirmation outputs for regulatory or QC needs.
Benefits and Practical Applications
- Reduced hands-on time and higher throughput through unattended acquisition and automated processing workflows.
- Robust sequence confirmation and impurity profiling suitable for therapeutic development, lot release, and stability studies.
- Standardized reporting templates improve traceability and accelerate documentation for internal review and regulatory submissions.
- Hardware and consumable choices optimized for oligonucleotide analysis (e.g., specialized HPH-C18 column, LC/MS-grade solvents, dedicated vials and fittings) enhance method robustness.
Future Trends and Potential Uses
- Broader adoption of integrated client–server software will enable centralized data governance across multi-instrument labs and facilitate remote operation and monitoring.
- Further automation of impurity annotation (e.g., enzymatic truncations, base modifications, adducts) using machine-learning–assisted spectral interpretation is anticipated.
- Expansion to other oligonucleotide modalities (ASOs, LNP-formulated siRNA, gRNA) and coupling to orthogonal techniques (ion mobility, higher-resolution MS/MS) would enhance characterization depth.
- Improved regulatory workflows: automated generation of submission-ready reports and audit trails will streamline compliance for advanced therapeutics.
Conclusions
An integrated software and hardware solution enabled automated, end-to-end LC–QTOF analysis of siRNA, delivering robust sequence confirmation and impurity profiling. The system’s automation features, targeted MS/MS capability, and templated reporting provide a practical, scalable approach for therapeutic oligonucleotide characterization in R&D and QC environments.Reference
The study evaluated inclisiran and givosiran as representative siRNA samples. Consumables and instrumentation examples used in the solution included Agilent Altura Oligo HPH-C18 column (2.1 × 50 mm, 2.7 µm), Agilent 6545XT Q-TOF, LC/MS-grade methanol and water, specialized solvent inlet filters, fittings, polypropylene vials and snap-top caps. (Agilent Technologies, ASMS 2026 poster WP 589.)Content was automatically generated from an orignal PDF document using AI and may contain inaccuracies.
Similar PDF
Analysis of Oligonucleotides Using Ion-Pairing Alternatives on the Agilent Pro iQ Plus
2025|Agilent Technologies|Applications
Application Note Biopharma Analysis of Oligonucleotides Using Ion-Pairing Alternatives on the Agilent Pro iQ Plus Authors Lee Bertram and Brian Rivera Agilent Technologies, Inc. Abstract This application note presents a practical approach for medium- to high-throughput molecular confirmation of synthetic…
Key words
moera, moeramoerc, moercmoerg, moergmethoxyethoxy, methoxyethoxyoligonucleotides, oligonucleotidesabundance, abundanceribose, riboseantisense, antisensemolecular, molecularoligonucleotide, oligonucleotidemoert, moertmass, massthreshold, thresholdfomivirsen, fomivirsenpairing
Analysis of Oligonucleotides Using an Ion-Pairing-Free Reversed-Phase Method with TOF LC/MS
2024|Agilent Technologies|Applications
Application Note Biopharmaceuticals Analysis of Oligonucleotides Using an Ion-Pairing-Free Reversed-Phase Method with TOF LC/MS Authors Lee Bertram and Jordy Hsiao Agilent Technologies, Inc. Abstract This application note details a reversed-phase separation methodology for oligonucleotides without the use ion pairing reagents.…
Key words
moera, moeramoerc, moercmoerg, moergcounts, countsmethoxyethoxy, methoxyethoxygivosiran, givosiranribose, ribosepairing, pairingoligonucleotides, oligonucleotidesoligonucleotide, oligonucleotidephase, phasemoert, moertacquisition, acquisitionreversed, reversedmass
High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry
2025|Agilent Technologies|Posters
Poster Reprint ASMS 2025 Poster number ThP 565 High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry Guannan Li and Lee Bertram Agilent Technologies, Inc., Santa Clara, CA Introduction Experimental Oligonucleotides are commonly analyzed by…
Key words
givosiren, givosirenoligos, oligosaso, asofomivirsen, fomivirsenantisense, antisensesense, senseoligo, oligoagca, agcaagcatgcatacaagaatgaatacatgca, agcatgcatacaagaatgaatacatgcacatgcatgcatgcatgcatgcatgcatg, catgcatgcatgcatgcatgcatgcatgmcfamgfamgfumamgfa, mcfamgfamgfumamgfamgfumcfumufufcmufcfa, mgfumcfumufufcmufcfamgmamamafgmafgmufg, mgmamamafgmafgmufgtgcatgcatgca, tgcatgcatgcatgcatgcatgcatgaatgcatgcataca
Fast Track to Certainty: Confident Biopharma Decisions with LC-Single Quadrupole Mass Detection
2025|Agilent Technologies|Guides
Table of contents Fast Track to Certainty: Confident Biopharma Decisions with LC-Single Quadrupole Mass Detection How single quadrupole LC/MS simplifies identification, purification, and stability assessment in biopharma Table of Contents Introduction��������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������������� 3 Consolidating Biopharma QC Workflows: LC/UV Versus Single Quadrupole…
Key words
contents, contentstable, tablemass, masspro, proplus, plusabundance, abundancetrastuzumab, trastuzumabmoera, moeraunknown, unknownrelative, relativeagilent, agilentabundances, abundancesmoe, moemoerc, moercthreshold