An Integrated Workflow for the Analysis of Oligonucleotides and Their Impurities by Agilent High-Resolution LC/(Q-)TOF Mass Spectrometry
Applications | 2022 | Agilent TechnologiesInstrumentation
LC/TOF, LC/HRMS, LC/MS, LC/MS/MS
IndustriesPharma & Biopharma
ManufacturerAgilent Technologies
Key wordsttttt, oligonucleotide, target, tpi, mass, oligonucleotides, counts, impurities, rna, oligo, sequence, deconvoluted, entropy, were, agilent, ladder, workflow, acquisition, advancebio, ccacgaccaagtgacagcaatgaatcgagtcgagatccat, related, dna, resolution, spectrum, masshunter, tic, data, accuracies, length, quantitation, synthetic, amu, fbf, analysis, maximum, find, ppm, tof, quant, excellent, relative, characterization, separation, min, sub, impurity, bioconfirm, standard, also, avg
Similar PDF
Oligonucleotide Characterization by Agilent 1290 Infinity II Bio LC and 6545XT AdvanceBio LC/Q-TOF
2023|Agilent Technologies|Applications
Application Note Pharma & Biopharma Oligonucleotides Oligonucleotide Characterization by Agilent 1290 Infinity II Bio LC and 6545XT AdvanceBio LC/Q-TOF Oligonucleotide identity, impurities analysis and sequence determination using BioConfirm 12.0 target plus impurities (TPI) and sequence confirmation workflows Authors Introduction Bian…
Key words
oligonucleotide, oligonucleotideaso, asosequence, sequencetpi, tpicounts, countsacquisition, acquisitionoligonucleotides, oligonucleotidesconfirmation, confirmationworkflow, workflowcharge, chargeimpurities, impuritiesbioconfirm, bioconfirmmass, massagilent, agilentfluoro
Comprehensive and Integrated Workflow for Oligonucleotide Sequence Confirmation by Agilent High-Resolution LC/Q-TOF
2022|Agilent Technologies|Applications
Application Note Biopharma/Pharma Comprehensive and Integrated Workflow for Oligonucleotide Sequence Confirmation by Agilent High-Resolution LC/Q-TOF Robust and sensitive sequence confirmation of synthetic oligonucleotides and impurities Authors David L. Wong and Peter Rye Agilent Technologies, Inc. Abstract This application note demonstrates…
Key words
oligonucleotide, oligonucleotidesequence, sequenceoligonucleotides, oligonucleotidesconfirmation, confirmationcounts, countscharge, chargemass, massfragment, fragmentworkflow, workflowrna, rnaimpurities, impuritiessequences, sequencesladder, ladderacquisition, acquisitiondata
Oligonucleotide Characterization by Bio LC and Q-TOF
2023|Agilent Technologies|Posters
Poster Reprint ASMS 2023 Poster number ThP 566 Oligonucleotide Characterization by Bio LC and Q-TOF Yulan Bian1, David L Wong2 1Agilent Technologies, Inc., Singapore 2Agilent Technologies, Inc., Santa Clara, CA Introduction Experimental Sample preparation Oligonucleotide (RNA) Resolution Standard was obtained…
Key words
oligonucleotide, oligonucleotidesequence, sequencetpi, tpioligonucleotides, oligonucleotidesconfirmation, confirmationimpurities, impuritiesworkflow, workflowmasshunter, masshunteravg, avgadvancebio, advancebiolength, lengthapta, aptaoerg, oergagilent, agilentbio
Comprehensive, Automated, and Integrated Software for Oligonucleotide Characterization and Sequence Confirmation
2022|Agilent Technologies|Posters
Poster Reprint ASMS 2022 Poster number WP386 Comprehensive, Automated, and Integrated Software for Oligonucleotide Characterization and Sequence Confirmation David Wong1; Peter Rye2; Stephen Madden1; Gordon Slysz1 and Crystal Cody1 1Agilent Technologies, Inc., Santa Clara, CA 2Agilent Technologies, Inc., Lexington, MA…
Key words
oligonucleotide, oligonucleotideoligonucleotides, oligonucleotidesmasses, massesbioconfirm, bioconfirmmsms, msmsconfirmation, confirmationanalysis, analysissequence, sequencehighlighted, highlightedmatched, matchedsynthetic, syntheticfbf, fbfsamples, samplesimpurities, impuritiesmodalities