RapidFire for Automated High-Throughput LC/MS
Guides | 2023 | Agilent TechnologiesInstrumentation
High-throughput LC/MS is essential for pharmaceutical and biotech laboratories that face growing sample volumes in drug discovery, metabolite identification, oligonucleotide characterization, and biophysical screening. The Agilent RapidFire system replaces time-consuming chromatographic separations with automated solid phase extraction and direct injection mass spectrometry, enabling cycle times of 2–15 seconds per sample. This ultrafast approach accelerates lead discovery, ADME profiling, and fragment-based screening by providing label-free quantitation, robust reproducibility, and seamless integration with triple quadrupole and high-resolution mass spectrometers.
To demonstrate the capabilities of RapidFire for high-throughput LC/MS across a range of applications, including:
Principles common to all applications:
Integration of ultrahigh-throughput MS with advanced automation and AI-driven method optimization will further accelerate screening and ADME pipelines. Expansion to native protein analyses, complex mixtures, and emerging modalities like oligonucleotide therapeutics will extend the utility of RapidFire/MS. Coupling with data analytics platforms will provide deeper biological insights and real-time decision-making for drug discovery.
Agilent’s RapidFire high-throughput mass spectrometry platform transforms traditional LC/MS workflows by replacing chromatographic separation with automated SPE, achieving cycle times as low as 2 s without sacrificing data quality. Across diverse applications—from small molecule screening to oligonucleotide analysis and metabolic stability assays—RapidFire delivers label-free, robust, and reproducible results at 5–15 s per sample, offering 5–10-fold speed improvements over LC/MS. This ultrafast MS approach streamlines lead discovery, ADME profiling, and method development, empowering laboratories to process tens of thousands of samples per day with minimal hands-on time and maximal data integrity.
Sample Preparation, LC/MS, LC/MS/MS, LC/QQQ
IndustriesForensics , Pharma & Biopharma, Clinical Research
ManufacturerAgilent Technologies
Summary
Significance of the topic
High-throughput LC/MS is essential for pharmaceutical and biotech laboratories that face growing sample volumes in drug discovery, metabolite identification, oligonucleotide characterization, and biophysical screening. The Agilent RapidFire system replaces time-consuming chromatographic separations with automated solid phase extraction and direct injection mass spectrometry, enabling cycle times of 2–15 seconds per sample. This ultrafast approach accelerates lead discovery, ADME profiling, and fragment-based screening by providing label-free quantitation, robust reproducibility, and seamless integration with triple quadrupole and high-resolution mass spectrometers.
Objectives and study overview
To demonstrate the capabilities of RapidFire for high-throughput LC/MS across a range of applications, including:
- Direct injection sub-2.5 s sample throughput for S-adenosylhomocysteine analysis
- Automated SPE method development for cyclic AMP screening
- Sample‐volume minimization to 5–10 µL for 96/384-well plates
- Oligonucleotide analysis by ion-pair-free HILIC and Q-TOF detection
- Comparison of Fast LC vs RapidFire desalting for 18–100 mer oligonucleotides
- Fragment-based screening of BACE-1 using labeled vs unlabeled substrates
- High-throughput screening of stearoyl-CoA desaturase inhibitors
- Ultrafast in vitro microsomal metabolic stability assays
Methodology and Instrumentation
Principles common to all applications:
- Automated SPE cleanup using RapidFire cartridges (C4, PLRP-S, HILIC-Z)
- Direct coupling to Agilent triple quadrupole or Q-TOF MS (Ultivo, 6470, 6495C, 6545XT)
- Optimized pump flows, valve timings (600–7,000 ms), and elution buffers for sub-2 s to 15 s cycle times
- Use of formic acid, TFA, acetonitrile, ammonium acetate buffers, and ion-pair-free mobile phases
- MassHunter RapidFire Integrator and BioConfirm for data processing
- Complementary Fast LC workflows employing UHPLC guard columns and dual-needle multisampler for comparison
Key Results and Discussion
- Direct Injection Mode: Achieved 2 s/sample throughput for S-adenosylhomocysteine with linear R2 = 0.9997, CV < 2 %, and perfect correlation with SPE-MS mode
- Automated Method Development: Reduced hands-on optimization to 12 min and walk-away time to 74 min for cAMP assay, improving peak shape and reducing carryover 20-fold
- Sample-Volume Reduction: By replacing 0.015" tubing with 0.009" or 0.005" id, sample consumption dropped from ~35 µL to 5–10 µL per well with CV < 4 %
- Oligonucleotide HILIC Analysis: Ion-pair-free HILIC-Z SPE enabled 12 s cycle times on 6545XT Q-TOF, achieving single-digit nM detection limits, broad dynamic range, and high reproducibility for 18 to 60 mer oligos
- Synthetic Oligo Screening: RapidFire desalting outperformed Fast LC in adduct removal, with 15 s/sample vs 40 s/sample and maintained signal across 18–100 mer sequences
- Fast LC vs RapidFire Comparison: Both methods yielded comparable data quality; RapidFire provided 10-fold faster throughput at the cost of chromatographic separation
- Fragment-Based Screening: In BACE-1 assay, MS vs fluorescence and labeled vs unlabeled substrates produced distinct hit sets, highlighting label-free detection’s advantages in avoiding autofluorescence and substrate bias
- Lead Discovery with SCD: RapidFire/TQ enabled rapid, label-free screening of stearoyl-CoA desaturase inhibitors at 6–10 s/sample, producing robust Z' ≈ 0.6 and consistent IC50 measurements
- Microsomal Stability: RapidFire/Ultivo TQ achieved R2 = 0.94 correlation with LC/TQ for 72 compounds, with 10 s/sample versus 100 s/sample, demonstrating 10-fold speed increase without data compromise
Benefits and Practical Applications
- Mass-guided label-free detection eliminates fluorophore or radiolabel artifacts
- Ultrafast cycle times reduce instrument time and per-sample costs
- Minimal method development for diverse analyte classes
- High reproducibility (CV < 3 %), linearity, and dynamic range
- Scalable to >130,000 samples with integrated plate handling
- Suitable for ADME, drug metabolism, oligonucleotide QC, and fragment screening
Future Trends and Opportunities
Integration of ultrahigh-throughput MS with advanced automation and AI-driven method optimization will further accelerate screening and ADME pipelines. Expansion to native protein analyses, complex mixtures, and emerging modalities like oligonucleotide therapeutics will extend the utility of RapidFire/MS. Coupling with data analytics platforms will provide deeper biological insights and real-time decision-making for drug discovery.
Conclusion
Agilent’s RapidFire high-throughput mass spectrometry platform transforms traditional LC/MS workflows by replacing chromatographic separation with automated SPE, achieving cycle times as low as 2 s without sacrificing data quality. Across diverse applications—from small molecule screening to oligonucleotide analysis and metabolic stability assays—RapidFire delivers label-free, robust, and reproducible results at 5–15 s per sample, offering 5–10-fold speed improvements over LC/MS. This ultrafast MS approach streamlines lead discovery, ADME profiling, and method development, empowering laboratories to process tens of thousands of samples per day with minimal hands-on time and maximal data integrity.
References
- Rye, P.; Yang, Y. High-Throughput Mass Spectrometry of Synthetic Oligonucleotides: A Comparison of Data from Fast LC and RapidFire Methods. ASMS 2020, TP 434.
- Lobue, P. A. et al. Oligonucleotide Analysis by HILIC-MS in the Absence of Ion-Pair Reagents. J. Chromatogr. A 2019, 1595, 39–48.
- Soulard, P. et al. Development of a High-Throughput Assay for Stearoyl-CoA Desaturase Using Deuterated Substrates. Anal. Chim. Acta 2008, 627, 105–111.
- Choi, N.-Y. et al. Ultrafast Analysis of In Vitro Microsomal Metabolic Stability Using RapidFire Coupled to Ultivo TQ. Agilent Technologies, Application Note, 2021.
- Frick, L. E.; LaMarr, W. A. Automated Method Development Using the Agilent RapidFire System. Agilent Technologies, Application Note, 2014.
Content was automatically generated from an orignal PDF document using AI and may contain inaccuracies.
Similar PDF
High-throughput Mass Spectrometry Analysis of Synthetic Oligonucleotides
2021|Agilent Technologies|Applications
Application Note High-throughput Mass Spectrometry Analysis of Synthetic Oligonucleotides A comparison of data from Fast LC and RapidFire methods Authors Peter Rye, PhD and Yanan Yang, PhD Agilent Technologies, Inc. Introduction Liquid chromatography (LC) and mass spectrometry (MS) play a…
Key words
rapidfire, rapidfirefast, fastoligo, oligothroughput, throughputmethod, methodgas, gastemperature, temperaturecounts, countssheath, sheathtime, timeflow, flowsec, secmass, massdata, dataoligos
High-throughput, Ion-Pairing-Free, HILIC Analysis of Oligonucleotides Using Agilent RapidFire Coupled to Quadrupole Time-of-Flight Mass Spectrometry
2022|Agilent Technologies|Applications
Application Note High-throughput, Ion-Pairing-Free, HILIC Analysis of Oligonucleotides Using Agilent RapidFire Coupled to Quadrupole Time-of-Flight Mass Spectrometry Author Abstract Peter Rye, PhD Agilent Technologies, Inc. This application note describes a high-throughput, ion-pairing-free method for oligonucleotide characterization using the Agilent RapidFire…
Key words
oligo, oligorapidfire, rapidfirecounts, countshilic, hilicoligos, oligosdeconvoluted, deconvolutedcharge, chargeamu, amumass, massdepurination, depurinationiprp, iprppredominant, predominantwere, weredeconvolution, deconvolutionheights
High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry
2025|Agilent Technologies|Posters
Poster Reprint ASMS 2025 Poster number ThP 565 High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry Guannan Li and Lee Bertram Agilent Technologies, Inc., Santa Clara, CA Introduction Experimental Oligonucleotides are commonly analyzed by…
Key words
givosiren, givosirenaso, asooligos, oligosfomivirsen, fomivirsenantisense, antisensesense, senseoligo, oligoagca, agcaagcatgcatacaagaatgaatacatgca, agcatgcatacaagaatgaatacatgcacatgcatgcatgcatgcatgcatgcatg, catgcatgcatgcatgcatgcatgcatgmcfamgfamgfumamgfa, mcfamgfamgfumamgfamgfumcfumufufcmufcfa, mgfumcfumufufcmufcfamgmamamafgmafgmufg, mgmamamafgmafgmufgtgcatgcatgca, tgcatgcatgcatgcatgcatgcatgaatgcatgcataca
Ultrafast Plasma Protein Binding Analysis
2022|Agilent Technologies|Applications
Application Note Ultrafast Plasma Protein Binding Analysis Using the Agilent RapidFire high-throughput mass spectrometry system and accurate mass Q-TOF Authors Abstract Kari E. Schlicht and Vaughn P. Miller Agilent Technologies, Inc. There has been increased demand for higher throughput in…
Key words
bound, boundrapidfire, rapidfiretof, tofspe, spedialysis, dialysisvoltage, voltagesheath, sheathwere, wereequilibrium, equilibriumgas, gasthroughput, throughputdrying, dryingmethod, methodplasma, plasmamrm