High-throughput Mass Spectrometry Analysis of Synthetic Oligonucleotides
Applications | 2021 | Agilent TechnologiesInstrumentation
The rapid growth of synthetic oligonucleotide applications in research and therapeutics demands analytical methods that combine speed with reliable desalting and characterization. High-throughput mass spectrometry workflows address these needs by minimizing run times while maintaining data quality.
This work compares two high-throughput approaches for oligonucleotide analysis: a Fast LC–Q-TOF method using an Agilent 1290 Infinity II system and a RapidFire 400–Q-TOF approach. Both workflows were optimized for 18-mer oligos and evaluated across DNA and RNA sequences from 18 to 100 nucleotides.
Fast LC: Dual-needle, smart-overlap injections on a guard column deliver a 0.6-minute gradient and desalting at 1.75 mL/min, acquiring 10 spectra/s.
RapidFire: A 4 µL PLRP-S cartridge executes a five-state cycle (aspirate, wash, elute, re-equilibrate) in ~13 s, with MS data collected continuously and parsed postacquisition at 4 spectra/s.
RapidFire offers ultrahigh throughput for large-scale QC, purity assessment, and impurity profiling with minimal chromatographic method development. Fast LC provides added separation to simplify mixture analysis and can be tuned to balance resolution and speed.
Oligonucleotide therapeutics growth will drive integration of rapid desalting platforms with automated sample handling and real-time data processing. Advances in cartridge chemistries, accelerated UHPLC gradients, high-speed detectors, and AI-driven deconvolution promise even faster cycle times, improved separation, and deeper impurity insights.
Both RapidFire and Fast LC high-throughput MS methods deliver robust, reproducible results for synthetic oligonucleotides. RapidFire excels in speed and impurity detection, while Fast LC adds separation for complex samples. These complementary workflows meet the accelerating analytical demands of oligonucleotide development and QC.
Sample Preparation, LC/TOF, LC/HRMS, LC/MS, LC/MS/MS
IndustriesPharma & Biopharma
ManufacturerAgilent Technologies
Summary
Significance of the topic
The rapid growth of synthetic oligonucleotide applications in research and therapeutics demands analytical methods that combine speed with reliable desalting and characterization. High-throughput mass spectrometry workflows address these needs by minimizing run times while maintaining data quality.
Study objectives and overview
This work compares two high-throughput approaches for oligonucleotide analysis: a Fast LC–Q-TOF method using an Agilent 1290 Infinity II system and a RapidFire 400–Q-TOF approach. Both workflows were optimized for 18-mer oligos and evaluated across DNA and RNA sequences from 18 to 100 nucleotides.
Methodology
Fast LC: Dual-needle, smart-overlap injections on a guard column deliver a 0.6-minute gradient and desalting at 1.75 mL/min, acquiring 10 spectra/s.
RapidFire: A 4 µL PLRP-S cartridge executes a five-state cycle (aspirate, wash, elute, re-equilibrate) in ~13 s, with MS data collected continuously and parsed postacquisition at 4 spectra/s.
Used instrumentation
- Agilent 1290 Infinity II Binary Pump with Dual-Needle Multisampler
- AdvanceBio Oligo UHPLC Guard Column (2.1 × 5 mm, 1.7 µm)
- Agilent RapidFire 400 high-throughput MS system with PLRP-S cartridge
- Agilent 6545 LC/Q-TOF Mass Spectrometer
- MassHunter Bioconfirm B07 software for deconvolution and analysis
Main results and discussion
- Throughput: RapidFire achieved ~15 s/sample (≈5 760/day); Fast LC required ~40 s/sample (≈2 160/day).
- Desalting efficiency: RapidFire reduced sodium and potassium adducts 2–3× more effectively than Fast LC over 18–100 mer lengths.
- Signal intensity: Fast LC produced lower overall peak intensity (25–80% relative) due to higher flow and narrower peaks but enabled partial chromatographic separation.
- Reproducibility: Both methods showed stable pump pressures and consistent retention profiles, with Fast LC retention times varying by ~7 s across oligo sizes and RapidFire eluting all sizes simultaneously.
- Impurity profiling: RapidFire deconvolution resolved low-abundance truncations, depurination/depyrimidation products, and cation adducts down to ~0.5% relative area.
Benefits and practical applications
RapidFire offers ultrahigh throughput for large-scale QC, purity assessment, and impurity profiling with minimal chromatographic method development. Fast LC provides added separation to simplify mixture analysis and can be tuned to balance resolution and speed.
Future trends and potential applications
Oligonucleotide therapeutics growth will drive integration of rapid desalting platforms with automated sample handling and real-time data processing. Advances in cartridge chemistries, accelerated UHPLC gradients, high-speed detectors, and AI-driven deconvolution promise even faster cycle times, improved separation, and deeper impurity insights.
Conclusion
Both RapidFire and Fast LC high-throughput MS methods deliver robust, reproducible results for synthetic oligonucleotides. RapidFire excels in speed and impurity detection, while Fast LC adds separation for complex samples. These complementary workflows meet the accelerating analytical demands of oligonucleotide development and QC.
Content was automatically generated from an orignal PDF document using AI and may contain inaccuracies.
Similar PDF
RapidFire for Automated High-Throughput LC/MS
2023|Agilent Technologies|Guides
RapidFire for Automated High-Throughput LC/MS Proven. Rapid. Complete. Application Compendium Table of Contents Introduction3 Application Notes Method Development High-Throughput (Sub-2.5 Second) Direct Injection Analysis by Mass Spectrometry 4 Automated Method Development Using the Agilent RapidFire High-Throughput Mass Spectrometry…
Key words
rapidfire, rapidfirecounts, countsthroughput, throughputsip, sipwere, weremass, massoligo, oligotof, tofagilent, agilentcartridge, cartridgehigh, highmethod, methoddata, dataoligos, oligosfrom
High-throughput Mass Spectrometry Analysis of Synthetic Oligonucleotides: A Comparison of Data from Fast LC and RapidFire Methods
2020|Agilent Technologies|Posters
Poster Reprint ASMS 2020 TP 434 High-throughput Mass Spectrometry Analysis of Synthetic Oligonucleotides: A Comparison of Data from Fast LC and RapidFire Methods Peter Rye, Ph.D. and Yanan Yang, Ph.D. Agilent Technologies Introduction Liquid chromatography (LC) and mass spectrometry (MS)…
Key words
rapidfire, rapidfirefast, fastoligo, oligothroughput, throughputoligos, oligosmethod, methoddepyrimidation, depyrimidationtruncations, truncationsblack, blackdepurination, depurinationred, redretention, retentionseparation, separationdiscussion, discussionreproducibility
High-throughput, Ion-Pairing-Free, HILIC Analysis of Oligonucleotides Using Agilent RapidFire Coupled to Quadrupole Time-of-Flight Mass Spectrometry
2022|Agilent Technologies|Applications
Application Note High-throughput, Ion-Pairing-Free, HILIC Analysis of Oligonucleotides Using Agilent RapidFire Coupled to Quadrupole Time-of-Flight Mass Spectrometry Author Abstract Peter Rye, PhD Agilent Technologies, Inc. This application note describes a high-throughput, ion-pairing-free method for oligonucleotide characterization using the Agilent RapidFire…
Key words
oligo, oligorapidfire, rapidfirecounts, countshilic, hilicoligos, oligosdeconvoluted, deconvolutedcharge, chargeamu, amumass, massdepurination, depurinationiprp, iprppredominant, predominantwere, weredeconvolution, deconvolutionheights
High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry
2025|Agilent Technologies|Posters
Poster Reprint ASMS 2025 Poster number ThP 565 High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry Guannan Li and Lee Bertram Agilent Technologies, Inc., Santa Clara, CA Introduction Experimental Oligonucleotides are commonly analyzed by…
Key words
givosiren, givosirenaso, asooligos, oligosfomivirsen, fomivirsenantisense, antisensesense, senseoligo, oligoagca, agcaagcatgcatacaagaatgaatacatgca, agcatgcatacaagaatgaatacatgcacatgcatgcatgcatgcatgcatgcatg, catgcatgcatgcatgcatgcatgcatgmcfamgfamgfumamgfa, mcfamgfamgfumamgfamgfumcfumufufcmufcfa, mgfumcfumufufcmufcfamgmamamafgmafgmufg, mgmamamafgmafgmufgtgcatgcatgca, tgcatgcatgcatgcatgcatgcatgaatgcatgcataca