High-throughput Mass Spectrometry Analysis of Synthetic Oligonucleotides: A Comparison of Data from Fast LC and RapidFire Methods
Posters | 2020 | Agilent TechnologiesInstrumentation
Synthetic oligonucleotides play a critical role in therapeutic development, diagnostics, and molecular biology research. As demand for these molecules grows, laboratories require faster, reliable analytical workflows. High-throughput mass spectrometry methods enable rapid desalting and analysis of oligos without full chromatographic separation, increasing sample throughput while maintaining data quality.
This study compares two high-speed workflows—Fast LC and RapidFire—for the analysis of synthetic DNA and RNA oligonucleotides ranging from 18 to 100 bases. Both methods were first optimized for 18mers and then assessed for throughput, desalting efficiency, signal intensity, separation capability, and impurity detection.
Both RapidFire and Fast LC high-throughput MS approaches deliver robust, reproducible oligonucleotide analysis. RapidFire offers unmatched speed and desalting efficiency, while Fast LC adds chromatographic selectivity, enabling tailored workflows for diverse analytical needs.
Sample Preparation, LC/TOF, LC/HRMS, LC/MS, LC/MS/MS
IndustriesPharma & Biopharma
ManufacturerAgilent Technologies
Summary
Importance of the Topic
Synthetic oligonucleotides play a critical role in therapeutic development, diagnostics, and molecular biology research. As demand for these molecules grows, laboratories require faster, reliable analytical workflows. High-throughput mass spectrometry methods enable rapid desalting and analysis of oligos without full chromatographic separation, increasing sample throughput while maintaining data quality.
Study Objectives and Overview
This study compares two high-speed workflows—Fast LC and RapidFire—for the analysis of synthetic DNA and RNA oligonucleotides ranging from 18 to 100 bases. Both methods were first optimized for 18mers and then assessed for throughput, desalting efficiency, signal intensity, separation capability, and impurity detection.
Methodology and Instruments
- Fast LC: An Agilent 1290 Infinity II multi-sampler with dual injection needles alternates sampling and analysis. A fast gradient at 1.75 mL/min through a guard column delivers desalting in ~35 seconds, plus ~5 seconds for MS acquisition restart. MS acquisition rate set to 10 spectra/sec.
- RapidFire: A cartridge-based system performs six-second desalting and six-second elution on a 4 µL resin bed. Total cycle time is ~13 seconds plus plate motion, with MS acquisition at 4 spectra/sec.
- Detection and Data Analysis: Time-of-flight mass spectrometer with data processing by MassHunter Bioconfirm B07.
Main Results and Discussion
- Throughput: RapidFire achieved ~15 s/sample (~240 samples/h, 5760 samples/day); Fast LC reached ~40 s/sample (~90 samples/h, 2160 samples/day). Both showed consistent pump pressures and reproducible gradients across 24 replicates.
- Desalting Efficiency: RapidFire reduced salt adduct formation to ~12–14% relative to the main peak for 18–100mers, compared with 25–39% for Fast LC.
- Signal Intensity: Normalized target peaks using RapidFire were 100% across all oligo sizes; Fast LC delivered 80% for 18mers down to 25% for 100mers.
- Separation Capability: RapidFire eluted all oligos at a single retention time, while Fast LC exhibited a ~7 s retention window across 18–100mers, enabling resolution of closely sized species such as 18mer vs. 20mer.
- Impurity Analysis: RapidFire deconvolution identified low-abundance impurities (down to ~0.5% relative area) in a 100mer guide RNA despite zero chromatographic separation.
Benefits and Practical Applications
- RapidFire workflow excels in ultra-high throughput QC environments, delivering fast sample desalting and comprehensive impurity profiling.
- Fast LC provides a balance of moderate throughput and chromatographic resolution, aiding analysis of complex mixtures and reducing ion suppression.
- Both methods yield reproducible, high-quality data across a broad oligonucleotide size range, supporting applications in research, drug development, and QA/QC laboratories.
Future Trends and Potential Applications
- Combining high-speed desalting with advanced MS detectors to enhance sensitivity and dynamic range.
- Implementing machine learning algorithms for automated impurity detection and data interpretation.
- Integrating high-throughput workflows into large-scale manufacturing QC and personalized oligo therapeutics analytics.
- Developing hybrid methods that merge rapid sampling with targeted chromatographic steps to optimize throughput and separation.
Conclusion
Both RapidFire and Fast LC high-throughput MS approaches deliver robust, reproducible oligonucleotide analysis. RapidFire offers unmatched speed and desalting efficiency, while Fast LC adds chromatographic selectivity, enabling tailored workflows for diverse analytical needs.
References
- Rye P., Yang Y. High-throughput Mass Spectrometry Analysis of Synthetic Oligonucleotides: A Comparison of Data from Fast LC and RapidFire Methods. Agilent Technologies. ASMS 2020; TP 434.
- Agilent Technologies. MassHunter Bioconfirm B07 Software User Guide.
Content was automatically generated from an orignal PDF document using AI and may contain inaccuracies.
Similar PDF
High-throughput Mass Spectrometry Analysis of Synthetic Oligonucleotides
2021|Agilent Technologies|Applications
Application Note High-throughput Mass Spectrometry Analysis of Synthetic Oligonucleotides A comparison of data from Fast LC and RapidFire methods Authors Peter Rye, PhD and Yanan Yang, PhD Agilent Technologies, Inc. Introduction Liquid chromatography (LC) and mass spectrometry (MS) play a…
Key words
rapidfire, rapidfirefast, fastoligo, oligothroughput, throughputmethod, methodgas, gastemperature, temperaturecounts, countssheath, sheathflow, flowtime, timemass, massdata, datasec, secoligos
RapidFire for Automated High-Throughput LC/MS
2023|Agilent Technologies|Guides
RapidFire for Automated High-Throughput LC/MS Proven. Rapid. Complete. Application Compendium Table of Contents Introduction3 Application Notes Method Development High-Throughput (Sub-2.5 Second) Direct Injection Analysis by Mass Spectrometry 4 Automated Method Development Using the Agilent RapidFire High-Throughput Mass Spectrometry…
Key words
rapidfire, rapidfirecounts, countsthroughput, throughputsip, sipwere, weremass, massoligo, oligotof, tofagilent, agilentcartridge, cartridgehigh, highmethod, methoddata, dataoligos, oligosfrom
High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry
2025|Agilent Technologies|Posters
Poster Reprint ASMS 2025 Poster number ThP 565 High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry Guannan Li and Lee Bertram Agilent Technologies, Inc., Santa Clara, CA Introduction Experimental Oligonucleotides are commonly analyzed by…
Key words
givosiren, givosirenoligos, oligosaso, asofomivirsen, fomivirsenantisense, antisensesense, senseoligo, oligoagca, agcaagcatgcatacaagaatgaatacatgca, agcatgcatacaagaatgaatacatgcacatgcatgcatgcatgcatgcatgcatg, catgcatgcatgcatgcatgcatgcatgmcfamgfamgfumamgfa, mcfamgfamgfumamgfamgfumcfumufufcmufcfa, mgfumcfumufufcmufcfamgmamamafgmafgmufg, mgmamamafgmafgmufgtgcatgcatgca, tgcatgcatgcatgcatgcatgcatgaatgcatgcataca
High-throughput, Ion-Pairing-Free, HILIC Analysis of Oligonucleotides Using Agilent RapidFire Coupled to Quadrupole Time-of-Flight Mass Spectrometry
2022|Agilent Technologies|Applications
Application Note High-throughput, Ion-Pairing-Free, HILIC Analysis of Oligonucleotides Using Agilent RapidFire Coupled to Quadrupole Time-of-Flight Mass Spectrometry Author Abstract Peter Rye, PhD Agilent Technologies, Inc. This application note describes a high-throughput, ion-pairing-free method for oligonucleotide characterization using the Agilent RapidFire…
Key words
oligo, oligorapidfire, rapidfirecounts, countshilic, hilicoligos, oligosdeconvoluted, deconvolutedcharge, chargeamu, amumass, massdepurination, depurinationiprp, iprppredominant, predominantwere, weredeconvolution, deconvolutionheights